Identification of Novel 58-5p and SREBF1 Interaction and Effects on Apoptosis of Ovine Ovarian Granulosa Cell

Le résumé fourni par la source

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1.

Ce résumé expose les affirmations des auteurs. BNTIC ne l’interprète pas comme une validation indépendante des résultats.