Lora Stepanian

Eleven-Year-Old Girl With Bilateral Leg Pain: A Case Report on Recognizing Hypoparathyroidism in Pediatric Practice

Devina Ramesh, Lora Stepanian, Rachel Parker, Julia Sorbara et autres

Hypoparathyroidism is a rare disorder that presents with a low total serum or ionized calcium, characterized by insufficient release of parathyroid hormone (PTH) from the parathyroid glands to maintain serum calcium. Patients with hypoparathyroidism may present with acute symptoms of muscle cramps, …

ca (code pays fourni par la source)

Chronic glucocorticoid management in neuromuscular disease: A survey of neuromuscular neurologists

Lora Stepanian, Ruple S. Laughlin, Corey Bacher, Aaron Izenberg et autres

INTRODUCTION/AIMS: Glucocorticoids (GC) are first-line therapy for many neuromuscular diseases. There is a lack of guidelines regarding the prevention and management of GC complications in the context of neuromuscular disease, introducing the potential for practice variation, that may compromise quality of care. …

ca, us (code pays fourni par la source)

Binding of l -Argininamide to a DNA Aptamer: A Volumetric Study

Lutan Liu, Lora Stepanian, David N. Dubins, Tigran V. Chalikian

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l -argininamide to its aptamer, the 24-base DNA hairpin 5′-d(GATCGAAACGTAGCGCCTTCGATC)-3′. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ K S, of 12 ± 7 …

ca (code pays fourni par la source)

Effect of urea on protein-ligand association

Lora Stepanian, Ikbae Son, Tigran V. Chalikian

ca (code pays fourni par la source)