CDKN1B Mutation Analyses and Biochemical Characteristics in Patients with Symptomatic or asymptomatic Primary Hyperparathyroidism: A Prospective Single-Centre Study

Le résumé fourni par la source

Background: The clinical phenotype of PHPT changed from overt bone and renal involvement to asymptomatic hypercalcaemia. Patients with symptomatic hyperparathyroidism should be referred for surgery, and asymptomatic patients’ management have still a clinical bias. Clinical variability can be linked to specific mutated gene including CDKN1B. Material-Methods: In this prospective study 80 patients (66 women and 14 men, mean age 50.8 ± 12.01 years) with PHPT were enrolled between 2018 and 2020. Biochemical and clinical information were collected on patients’ sex, age, biochemical examination and radiological findings (nuclear 99 mTc sestamibi scans scintigraphy, cervical ultrasound). CDKN1B sequencing, and DNA isolation was performed by using GeneMATRIX Quick Blood DNA Purification Kit. Selected primer of CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) and CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) were amplified by polymerase chain reaction (PCR) (Solis Biodyne, Estonia). Results: 22 of all patients were also symptomatic. Serum calcium and 24-hour calcium excretion were significantly increased in patients with symptomatic PHTP (p = 0.009, p = 0.00). Serum PTH levels were similar between the two group (p = 0.667). With regards to classical manifestations of PHPT, bone diseases (p = 0.04) and nephrolithiasis (p = 0.03) were more common in patients with symptomatic PHPT. CC genotype was detected in all patients with PHPT in rs786201010. c.-456_-453delCCTT was not detected in any patients. Conclusion: We emphasized that patients with symptomatic PHPT had more increased serum calcium levels and calciuria. Independent of PTH levels, clinical signs and symptoms could be related with serum calcium parameters in these patients.

Ce résumé expose les affirmations des auteurs. BNTIC ne l’interprète pas comme une validation indépendante des résultats.